Extract a per-sample allele table
pmo_extract_alleles_per_sample_table.RdBuilds a long table of library sample, target, and representative microhaplotype sequence, with optional additional metadata columns. This is the table consumed by downstream tools (dcifer, moire, ...).
Usage
pmo_extract_alleles_per_sample_table(
pmo,
additional_specimen_info_fields = NULL,
additional_library_sample_info_fields = NULL,
additional_microhap_fields = NULL,
additional_representative_info_fields = NULL,
default_base_col_names = c("library_sample_name", "target_name", "seq"),
validate = FALSE
)Arguments
- pmo
A
PortableMicrohaplotypeObjector parsed PMO list.- additional_specimen_info_fields, additional_library_sample_info_fields, additional_microhap_fields, additional_representative_info_fields
Optional character vectors of extra fields to include from the respective objects; an error is raised if a requested field exists nowhere.
- default_base_col_names
Length-3 character vector naming the sample, target, and sequence columns.
- validate
If
TRUE, validate the PMO against the schema first.
Examples
pmo <- read_pmo(
system.file("extdata", "example_pmo.json.gz", package = "pmotoolsr"))
head(pmo_extract_alleles_per_sample_table(pmo))
#> # A tibble: 6 × 4
#> library_sample_name target_name seq bioinformatics_run_n…¹
#> <chr> <chr> <chr> <chr>
#> 1 SRR30825770 SA_1021483 CAATATAATAACCTAATAAAAT… detected_microhaploty…
#> 2 SRR30825770 SA_11537 AAAGGTAAAGAAGTTTCTGTAA… detected_microhaploty…
#> 3 SRR30825770 SA_11580 TGCGCCGACCATTTATGGTGGT… detected_microhaploty…
#> 4 SRR30825770 SA_1281766 TAGCATTTGTAAATGAAAGTAA… detected_microhaploty…
#> 5 SRR30825770 SA_131432 GATAAGCTGATGCGTTACATTA… detected_microhaploty…
#> 6 SRR30825770 SA_166442 GTTTCATAAAAAAACCACCTTT… detected_microhaploty…
#> # ℹ abbreviated name: ¹bioinformatics_run_name